pVAX1

Brian Naughton | Wed 13 August 2014 | biotech | synthetic biology DNA vaccine vector

Via Life Technologies website, the pVAX1 vector sequence. It's 2999nt long.

GACTCTTCGCGATGTACGGGCCAGATATACGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATAT
ATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAG
TAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGACTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCC
CCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTC
ATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCA
ATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGA
GGTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCACTGCTTACTGGCTTATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTGGCTAG
CGTTTAAACTTAAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGAGGG
CCCGTTTAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCA
CTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGG
GGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGCTTCTACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAG
CTGGGGCGCCCTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTCGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGCTCTGATCA
AGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCA
CAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATG
AACTGCAAGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCT
GCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACG
CTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGG
ACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGAGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTG
CTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACC
CGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCC
TTCTTGACGAGTTCTTCTGAATTATTAACGCTTACAATTTCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATACAGGTGGC
ACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTC
AATAATAGCACGTGCTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTC
GTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCG
CTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAG
TGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAA
GTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGA
ACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGG
TCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTT
GTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGGCTTTTGCTGGCCTTTTGCTCACATGTTCTT

Comment

2014-08-13 Progress Report

Brian Naughton | Wed 13 August 2014 | biotech | synthetic biology DNA vaccine vector

Aldevron

Aldevron posted about offering "open-source" vectors on facebook. Aldevron links to their plasmid page, which offers 2µg of two "plasmids for vaccine validation" for free! Awesome!

pCMV-S (also known as pRc/CMV-HBs) is widely used to validate DNA vaccine delivery and formulation strategies. This plasmid expresses the hepatitis B surface antigen (HBsAg) under the control of the CMV immediate-early promoter. pCMVHB-S2.S expresses the small and middle forms of recombinant HBsAg. The plasmid can be used to generate anti-HBsAg antibodies like pCMV-S. It is also used to fuse other sequences to the S form of HBsAg.

pVAX1

The pVAX1 technical specification document says you can find the sequence online. It also says that pVAX1 is based on pcDNA

pVAX1™ was constructed by modifying the vector, pcDNA™3.1, to accommodate the following considerations put forth by the FDA Center for Biologics Evaluation and Research (CBER) in its document, “Points to Consider on Plasmid DNA Vaccines for Preventive Infectious Diseases Indications” (Docket no. 96N-0400). - Sequences not necessary for replication in E. coli or for expression of recombinant protein in mammalian cells were removed to limit DNA sequences with possible homology to the human genome and to minimize the possibility of chromosomal integration. - The kanamycin resistance gene was substituted for the ampicillin resistance gene because aminoglycoside antibiotics are less likely to elicit allergic responses in humans.

A database of DNA vaccines, DNAVaxDB shows pcDNA3.1 as the most commonly used vector, but pVAX1 is also popular.

BioBricks

BioBricks has some plasmid backbones but nothing obviously useful as a DNA vaccine vector.

Comment

2014-08-12 Progress Report

Brian Naughton | Tue 12 August 2014 | biotech | synthetic biology DNA vaccine vector

More Vectors

I am still looking for a DNA vaccine vector that I'm comfortable with. It may be impossible to choose perfectly, but at least I should be able to justify the choice of vector to myself. It's also best if the vector is open-source, or at least cheap.

Williams

There are a couple of very informative papers by James Williams from Nature Technology Corporation (NTC): (Williams et al. 2009, Williams 2013). For some reason the 2013 paper ("Vector Design for Improved DNA Vaccine Efficacy, Safety and Production") is not on pubmed so I am including the title here.

Williams points to pVAX1 and gWIZ as "first-generation" DNA vaccine vectors. pVAX1 an extremely minimalist vector, much more so than other "expression vectors" I've seen for sale. It's basically the vector I've been expecting but unable to find. However, Williams claims that the performance of first-generation vectors is poor due to several poor design choices. Williams' company (NTC) makes a "third-generation" vector that has a number of claimed advantages: mainly increased expression but also adherence to regulatory guidelines.

One modification NTC has made is that their vector is not selected for using antibiotics like pVAX1. There is a good reason for this (see below), but it means that the vector apparently must be grown up in a specialized E. coli...

The European Medicines Agency (EMA) has further concluded that kanamycin and neomycin are of importance for veterinary and human use and cannot be classified as having minor therapeutic relevance due to current use in critical clinical settings. To address these regulatory concerns, alternative non-antibiotic selection methods are needed.

Software

I went back to Teselagen and Benchling to see if either had a straightforward way to embed a protein in a pre-defined expression vector. If there was, I did not find it... (In retrospect, Genome Compiler may be better at this.) I think the problem is that these programs are really designed for operating at a lower level than I want. If I want to manipulate DNA sequence, I'm not sure I want to use a GUI at all. Rather, I want something more like a wizard that solves my specific use-case and assures me that all the hard-to-check things (protein phase, RNA secondary structure) are ok. I'm sure I'll come back to try these programs again though...

The best software I have found so far for my needs is DNA 2.0's website. Unfortunately, to my knowledge, DNA 2.0 does not have a DNA vaccine vector and the cost per base is prohibitively high.

Commercial vectors

Most vectors seem to be designed for producing and harvesting recombinant protein, so there's a focus on tagging and protein recovery. I don't need that, and it could even be detrimental to protein function. After reading Williams' paper, it turns out these are just the wrong vectors and that there are better choices.

These Sigma Aldrich vectors, which are a good example of the typical vector product page. Confusingly, there are "transient" or "stable" types — the "stable" expression vectors have an additional neo gene (neomycin), which allows you to select cells where rare integrations have occurred. Every vector has 1-3 N- or C-terminus FLAG peptides (22-66 amino acids) and/or c-Myc to allow for protein purification.

DNA 2.0 also has a nice tool to select from their mammalian expression vectors. These vectors are very inexpensive at $200 but again they are not designed for use as DNA vaccines.

One commenter notes that he does not like Life's pSecTag vector because it includes NcoI cleavage sites, which means he cannot use this restriction enzyme to clone into the MCS. That's something I didn't think about...

Next steps

I'll need to reread the Williams papers, and then pick one of the few available DNA vaccine-specific vectors, and see if it's possible to use it in combination with my protein.

Comment